The CRISPR Journal
○ SAGE Publications
Preprints posted in the last 30 days, ranked by how well they match The CRISPR Journal's content profile, based on 33 papers previously published here. The average preprint has a 0.01% match score for this journal, so anything above that is already an above-average fit.
Liu, B.; Qi, C.; Kanie, T.
Show abstract
Targeted protein degradation using conditional degron tag (CDT) technology is a powerful method for rapidly degrading a protein of interest (POI) upon the addition of a degrader drug. A prerequisite for the temporally controlled degradation of an endogenous POI is the generation of homozygous knock-in cells with the degron tag integrated at either the N- or C-terminus of their gene loci. However, obtaining those homozygous knock-in cells often requires selecting many single-cell clones, as human cells typically exhibit low homology-directed repair (HDR) activities. Additionally, tagging a degron to an endogenous protein may inadvertently reduce protein expression, potentially affecting protein function even before the drug is administered. Here, we develop a method for generating degron-tagged knock-in cells that allows us to skip the laborious single-cell cloning. This method arose from our observation that most knock-in cells carry the degron tag only in one allele (heterozygous), while the other allele typically harbors a frameshift insertion/deletion. This observation allowed us to bypass the need for single-cell cloning. We validated our method by knocking in degron tags at the N-terminus of cytoplasmic dynein1 subunits or Adaptor Protein 2 (AP2) subunit. Our experiments confirmed the rapid degradation of these proteins and their functional inhibition in bulk cell populations. Additionally, to mitigate the reduced expression often associated with the degron tagging, we established a method to control expression levels by inserting a mini-promoter immediately upstream of the knock-in cassette. Our method simplifies the workflow for degron tag knock-ins and enhances the versatility of these valuable technologies.
Orosco, C.; Jain, P. K.; Rivers, A. R.
Show abstract
Protospacer adjacent motifs (PAMs) and target-adjacent motifs (TAMs) are essential for target recognition by CRISPR-Cas and TnpB nucleases. Here we present TAMIPAMI, an efficient experimental and computational framework for rapid PAM/TAM identification. TAMIPAMI requires only a single control library and Cas or TnpB-treated library, simplifying experimental design, reducing cost, and providing greater accessibility for users. The platform interprets sequencing data with interactive visualizations and introduces a novel algorithm that determines the minimal exact set of degenerate IUPAC sequences describing the observed PAM/TAM patterns. Using this approach, we accurately recovered canonical motifs for several nucleases, including SpCas9, LbCas12a, AsCas12a, BrCas12b, Cas12i1, and AmaTnpB. TAMIPAMI is available as both a web application and command-line tool, ultimately providing an accessible and efficient platform for PAM/TAM discovery and characterization across CRISPR and OMEGA systems.
Kyung, J.; Esfahanian, M.; Mann, J.; Koke, E.; Pham, K.; Peng, Y.; Exposito-Alonso, M.
Show abstract
Polygenic traits require the coordinated effects of multiple genes. Such complex traits have been a long-term target of study for geneticists, but multiplex CRISPR--the editing of multiple loci in the genome via multiple guide RNAs--is in its infancy. Reviewing 106 plant studies using multiplex CRISPR, we find that the multiplexing capacity has doubled every 5.4 years; furthermore, a systematic experiment with 8, 16, and 24 simultaneous targets in Arabidopsis thaliana reveals that efficiency of 24-plex editing can reach up to 73% across over one hundred third-generation transformed plants sequenced. Our experiment revealed that the level of multiplexing, or the number of the targets, causes minor efficiency reduction compared to the other uncontrolled factors such as gRNA design or variation across plants. When we model the decay in editing efficiency as a function of the gRNA number, actual efficiency is higher than the expectation from both Cas9 competition interference and simple joint editing stochasticity models. Rather, efficiency decayed with diminishing interference with more gRNAs with substantial overdispersion attributed to other efficiency factors, such as PAM identity. We predict that editing close to 100 genes in a plant can be feasible with reasonably large plant screens; however, feasible and reliable polygenic genome engineering will necessitate developments outside of [insert novelty of this study in how multiplex CRISPR was implemented, here]. Author ContributionsM.E.-A. conceived the project and secured funding. M.E.-A. and M.Es. designed the experimental strategy. M.Es. established the multiplex CRISPR and transformation pipelines in the laboratory, propagation through the T1 and T2 generations, and oversaw the first amplicon sequencing. Y.P. established the in-house iSeq amplicon sequencing protocol and contributed to cloning and genotyping pilots. M.Es supervised K.P. to construct cloning, bacterial transformations, plant growth, floral-dip transformations, and selection of T1 plants. E.K. contributed to early amplicon genotyping. J.K. propagated and sampled the T3 and J.K. and J.M. conducted the final amplicon sequencing panel. J.K. and M.E.-A. performed gene editing variant mapping, dataset quality control, and summarized results from published multiplex CRISPR studies. M.E.-A. modeled editing efficiency. J.K and M.E.-A. generated figures and wrote the first draft. All authors revised and improved the manuscript. J.K. and M.Es. contributed equally to this work and are designated as co-first authors.
Nakamura, T.; Ando, T.; Matsuoka, Y.; Niimi, T.
Show abstract
CRISPR-Cas genome editing toolkits have expanded the scope of genetic studies in various emerging model organisms. However, their applications are limited mainly to knockout experiments due to technical difficulties in establishing knock-in strains, which enable in vivo molecular tagging-based experiments. Here, we investigated knock-in strategies in the harlequin ladybug Harmonia axyridis, a model insect for evolutionary developmental biology, which shows more than 200 color pattern variations within a species. We tested several knock-in strategies using synthetic DNA templates. We found that ssDNA templates generated founder knock-in strains efficiently (2.5-11%), whereas the 5 regions of ssDNA templates were frequently deleted when the insert length exceeded [~]40 bases. To overcome this limitation, we designed several 3 extended DNA templates. Fast-annealed 3-extended double-stranded DNA templates, which were designed for tagging endogenous proteins with epitope tags, showed high founder generation efficiency (9.9-20.9%) and accuracy (30.8-85.7%). This strategy is also applicable to the two-spotted cricket Gryllus bimaculatus, suggesting that the fast-annealed 3-extended dsDNA template is a versatile DNA template for generating knock-in strains in emerging model insects for developmental genetic studies. Summary statementFast-annealed 3-extended dsDNA templates facilitate efficient CRISPR-Cas9-mediated knock-in in emerging model insects.
Thrikawala, S.; Naples, B.; Rosowski, E.
Show abstract
One feature key to the versatility of zebrafish as an animal model for biomedical research is the breadth of genetic tools available, including for transgenesis. While the Tol2 transposase system remains the gold standard, its efficiency can be highly variable. Here, we explored the potential of a complementary transgenesis system, Cp36, a large serine recombinase identified from Clostridium perfringens previously found to efficiently integrate target cargo into the human genome without a preinstalled attB site. We generated Cp36-based plasmid constructs for zebrafish transgenesis and compared their performance to matched Tol2 plasmids across multiple experimental contexts, including transient expression, germline transmission, and multi-transgene expression. Cp36 integrates small [~]3.5kb cargo into the zebrafish genome and transmits to the next generation as efficiently as Tol2, but Cp36 performance declines substantially for larger [~]7.5kb constructs. Both Cp36 and Tol2 have comparable efficiency in transiently expressing a second construct regardless of the transposase/recombinase used to integrate the first construct, indicating compatibility with sequential transgenesis strategies. In summary, we demonstrate that Cp36 functions as a new alternative transgenesis method in zebrafish.
Christou-Smith, S.; Macfarlane, C.; Caulder, A.; Codner, G. F.; Dowding, S. N.; Mackenzie, M.; Desjardins, J.; Liu, K. J.; Isles, A. R.; Stewart, M. E.; Wells, S.; Teboul, L.
Show abstract
The high efficiency of genome editing presents a challenge when modifying genes associated with viability, welfare, or fertility issues, as implementation of the technology frequently results in mosaic animals with bi-allelic mutations. Combining deactivated Cas9 (dCas9) with Cas9 has been proposed as a strategy to protect one of the two target alleles from editing. We piloted this strategy with 11 genes that are reported as homozygous lethal or associated with welfare issues. We showed that the viability of founders was significantly increased when using 80:20 or 90:10 dCas9:Cas9 ratios, whereas the 70:30 ratio did not yield an equivalent protective effect. The associated overall production rate of mutated founder per manipulated embryo was significantly higher for the 80:20 ratio. Concomitantly, an increased proportion of dCas9 was associated with a significant increase in retention of unedited target alleles but, importantly, did not hinder germline transmission. In addition, editing genes in a paralog cluster with a combination of dCas9 and Cas9 reduced unwanted off-target editing, illustrating a further potential applicability of this approach. This study defines the optimal ratio between dCas9 and Cas9 for strategies aimed at achieving mono-allelic mutations within mosaic founders and proposes a means to reduce the incidence of off-target effects in experiments with limited gRNA options.
Ni, L.; Murakami, T.; Suzuki, S.; Hamao, M.; Nakamura, M.; Okubo, C.; Takahashi, K.
Show abstract
Advances in transcriptome profiling have revealed transcriptomic differences across different cellular states. However, functional interpretation requires precise perturbation tools and experimental frameworks. This study benchmarked two widely used modalities: CRISPR interference (CRISPRi) and Cas13d/CasRx. A standardized workflow was established to generate human pluripotent stem cells (PSCs) with inducible ZIM3-dCas9 or CasRx expression. The cell lines were subjected to flow cytometry, copy number, and immunocytochemical analyses. The knockdown performance was validated via robust OCT4 suppression and the expected downstream effects on pluripotency genes. Time-course measurements indicated that CRISPRi produced faster and stronger repression but slower recovery after inducer withdrawal. In contrast, CasRx yielded slower and typically weaker knockdown with rapid reversibility. Furthermore, a key limitation of CRISPRi was demonstrated using the ATF5-NUP62 locus, wherein CRISPRi could co-repress genes with overlapping promoter regions. In contrast, CasRx avoids these limitations and supports isoform-resolved targeting of circular and alternatively spliced transcripts, albeit with variable efficiency. These results provide practical guidance for selecting complementary knockdown tools to improve the interpretability of transcriptomic function studies. MOTIVATIONAdvances in transcriptome profiling have enabled the detection of subtle cell type-specific differences. However, mechanistic interpretation still depends on perturbation tools that can modulate transcripts with high precision and efficiency. Recent CRISPR-based modalities, CRISPRi and Cas13/CasRx, function as robust and orthogonal methods to achieve the knockdown of specific gene targets. However, a standardized approach for cell line preparation and comparative studies on their relative performances and limitations remains unclear. Consequently, this study presents a standardized workflow for generating cell lines that support high-efficiency knockdown using CRISPRi and CasRx. Moreover, it compares the trade-offs in potency, reversibility, and isoform resolution, along with a practical overview of method-specific pitfalls to guide tool selection and data interpretation in future studies. HIGHLIGHTSO_LIDoxycycline-inducible AAVS1 knock-in human PSC platforms for CRISPRi (ZIM3-dCas9) and CasRx (RfxCas13d) were generated to enable standardized RNA perturbation experiments. C_LIO_LIThe prepared cell lines demonstrated strong OCT4 knockdown, with expected downstream effects on the expression of another pluripotency gene, NANOG. C_LIO_LIA comparison of knockdown characteristics and their reversibility revealed rapid and sustained repression with CRISPRi, whereas slow but rapid recovery was observed with CasRx. C_LIO_LIA CRISPRi-specific off-target effect arising from TSS proximity/overlap (ATF5-NUP62) was identified, whereas CasRx achieved ATF5 knockdown without collateral repression of the neighboring NUP62 gene. C_LIO_LICasRx enables isoform-resolved knockdown of structural isoforms (circHIPK3 vs. linear HIPK3 mRNA) and splice isoforms (RAB6A-iso1 vs. RAB6A-iso2). C_LI
Lin, K.-H.; Lam, A.; Ooijen, S.; Maier, M.; Kassis, G.; Ellis, R.; Messemer, K.; Martin, J.; Khairallah, R.; Wagers, A. J.
Show abstract
Duchenne muscular dystrophy (DMD) is the most common, lethal X-linked neuromuscular disorder of childhood and is caused by mutations in the Dmd gene that disrupt dystrophin expression. Although adeno-associated virus-mediated gene therapies hold tremendous promise for DMD treatment, their clinical applications have been limited by dose-dependent vector and genome-level toxicities. Here, we developed and tested a single-vector adenine base editing strategy as a potentially safer genome editing approach to recode the pathogenic nonsense mutation into a benign missense mutation in mdx4cvDMD mouse model. Delivered using a muscle-tropic adeno-associated virus (MyoAAV) at a clinically-feasible dose (4E13 VG/kg), this strategy enabled detectable molecular recoding of the mdx4cv mutation in mice ranging in age from 3 days to 6 months. Yet, the overall efficiency and therapeutic impact of in vivo base editing with this system was highest in mice treated at the juvenile stage, with animals administered MyoAAV vectors at 3 weeks of age showing robust recovery of dystrophin expression and significant improvement in muscle contractile properties only one month later. Notably, introduction of adenine base editors either earlier in development, in neonatal mice, or later, in adulthood, yielded substantially lower editing efficiencies, particularly in muscle satellite cells whose editing is essential to ensure durable rescue of dystrophin expression in growing and regenerating muscle. Taken together, these results demonstrate the therapeutic potential of single-vector adenine base editing for DMD and underscore the importance of recipient age and disease stage in achieving optimal treatment outcomes for this and other genetic muscle disorders.
Loke, S.; Movva, N. S. V.; Hota, M.
Show abstract
TP53 is mutated in roughly half of all human cancers. Eight recurrent missense substitutions in the DNA-binding domain (R175H, Y220C, G245S, R248Q, R248W, R249S, R273H, R282W) account for most of the mutational burden. Homology-directed repair (HDR) with a wild-type donor template is one of the few feasible routes to revert these alleles, but existing CRISPR sgRNA design tools rank candidates without reference to the cancer cohort being treated. We built a reproducible pipeline that prioritizes SpCas9 sgRNAs for HDR-mediated correction of TP53 hotspot codons. The pipeline uses NM 000546.6 from NCBI, GRCh38 off-target search via Cas-OFFinder with the published Doench-2016 CFD matrices, on-target Doench-2016 (Rule Set 2) scores from CRISPOR, and per-cohort hotspot prevalence from three TCGA Pan-Cancer Atlas studies (HGSOC, n = 523; PDAC, n = 179; CRC, n = 534) accessed through cBioPortal. We enumerate guides whose cut sites fall within {+/-}10 nt of each hotspot codon, exclude any candidate that fails to map to GRCh38, and score the remainder. The final set contains 21 SpCas9 NGG sgRNAs across the seven hotspots, with no PAM-desert residues. A single candidate at R248 (TP53-248-P-ad878223; spacer GCATGGGCGGCATGAACCGG, AGG PAM; off-target specificity 0.913 over 806 reference-genome hits) ranks first in all three cohorts and holds rank 1 in 97% of 147 weight settings tested. Four additional residues (R175, Y220, R273, R282) yield within-residue tier-1 picks robust in 100% of weight settings. Cohort-specific differences appear only in cross-residue ordering: R175 and R282 climb in CRC, consistent with the higher prevalence of R175H and R282W in colorectal tumors.
Zhu, Z.; Dong, X.; KIM, C. H.; Maugee, C.; Barbazuk, W. B.; Vulpe, C.; Bacher, R.
Show abstract
Pooled CRISPR screens are widely used to investigate gene function and uncover genetic interactions. However, benchmarking computational methods for detecting gene-by-environment (GxE) interactions remains difficult because ground truth is rarely available and existing simulation tools are not designed for GxE screening contexts. To address this, we developed simCRISPR, a flexible simulation framework for generating pooled CRISPR screen data under complex experimental designs. Using simulated datasets informed by empirical CRISPR screen designs, we evaluated commonly used analysis methods, comparing normalization strategies based on safe-harbor versus non-targeting sgRNAs and assessing empirical log2FC thresholds as an additional effect-size criterion. We found that safe-harbor-based normalization improved interaction detection when DNA damage-related effects were present, particularly when combined with empirical log2FC thresholding for DESeq2. Application of this workflow to a doxorubicin GxE screen further showed that safe-harbor-based normalization reduced bias in log2FC distributions and identified additional biologically relevant candidates. simCRISPR is available at https://github.com/bachergroup/simCRISPR.
Rynes, T. P.; Osman, E. A.; McKeague, M.; Mruk, K.
Show abstract
Chemogenetic tools enable conditional control of gene expression during embryonic development and regeneration. However, many conditional tools induce constitutive or one-way activity precluding temporal resolution of gene function or require the use of multiple transgenic lines. We developed an RNA-based chemogenetic approach to induce gene expression in zebrafish embryos and larvae. We demonstrate that a gene of interest can be turned on in a time-dependent and concentration-dependent manner. Using this approach, we have characterized two different aptamers for future investigation.
Mehta, M.; Ahmed, K.; Hussein, R.; Tavares, E.; Berberovic, Z.; Adele, R.; D'Souza, A.; Gu, B.; Wilson, M. D.; Ivakine, E.; Monnier, P. P.; Heon, E.; Vincent, A.
Show abstract
Transgenic mouse models are indispensable for dissecting disease mechanisms; yet, their interpretability is frequently compromised by cryptic genomic alterations introduced during transgenesis. Thus, robust quality control strategies are needed to elucidate integration architecture and evaluate model performance when such unintended events occur. Here, we applied unbiased whole-genome long-read sequencing using the PacBio Revio to investigate a mouse model exhibiting unexpected transgene silencing, originally designed to recapitulate autosomal-dominant hereditary macular dystrophy driven by upregulation of a ZZEF1-ALOX15 fusion gene. Long-read sequencing analysis revealed a [≥]29-kb head-to-tail concatemer containing more than three copies of the transgene vector. Reconstruction of transgene-genome junctions revealed off-target integration of the concatemer into the calcium-sensing receptor gene (Casr), along with exogenous E. coli DNA, that together defined final transgene architecture. 5-methylcytosine profiling identified hypermethylation of the transgene promoter and additional phenotyping indicated disruption of endogenous Casr function resulting from the rearrangement. Our workflow enabled direct detection of transgene concatenation and off-target mapping. These findings establish long-read sequencing as a powerful and scalable quality control standard for genetically engineered animal models, uniquely capable of uncovering hidden genomic complexity, resolving aberrant phenotypes, and enhancing the reliability of in vivo disease modelling.
Wang, Z.; Ni, Y.; Cai, W.; Li, H.; Duan, Y.
Show abstract
BackgroundMetazoan adenosine-to-inosine (A-to-I) mRNA editing temporospatially diversifies the neuronal transcriptome and proteome. The limited read length from next-generation sequencing (NGS) constrains the quantification of the potentially differential editing levels across different splicing isoforms, restricting our understanding of the extent to which RNA editing contributes to molecular diversity and its interplay with splicing. MethodsWe employed reverse transcription nested PCR (RT-nPCR) and developed a novel interfering-Primer PCR (iPrimer PCR) technique to distinguish different transcripts of any gene. We selected multiple essential genes exhibiting RNA editing in coding sequences (CDSs) or untranslated regions (UTRs) for isoform-specific amplification and Sanger sequencing. ResultsNine different Adar isoforms together with pre-mRNA had distinct editing levels at the S>G auto-recoding site, which was predicted to have isoform-specific effects on catalytic activities. Although pre-mRNA editing might exert isoform-dependent promotion/suppression of splicing, closely located editing sites, such as those in neuronal genes qvr and stj, still exhibited high correlation in editing levels due to co-editing. iPrimer strategy further discovered differential recoding levels between the long/short 3UTR isoforms of gene jef. ConclusionsWe provide the first comprehensive solution for isoform-specific PCR amplification of any gene, enabling quantification of RNA editing level of different isoforms. Our results offer insights into how RNA editing interplays with splicing, and highlight its complicated role in expanding molecular diversity. Graphical abstract O_FIG O_LINKSMALLFIG WIDTH=200 HEIGHT=79 SRC="FIGDIR/small/725286v1_ufig1.gif" ALT="Figure 1"> View larger version (17K): org.highwire.dtl.DTLVardef@1ebc82org.highwire.dtl.DTLVardef@1ea365dorg.highwire.dtl.DTLVardef@1971aceorg.highwire.dtl.DTLVardef@160d053_HPS_FORMAT_FIGEXP M_FIG C_FIG We developed isoform-specific PCR followed by Sanger sequencing, and achieved the quantification of differential RNA editing levels in different transcripts of a gene.
Chung, J. H.; Donahue, R. R.; Griffiths, J. A.; Fan, Y.; Lin, C.; Chen, X.; Dutta, S.; Mazmanian, S.; Seifert, A. W.; Gradinaru, V.
Show abstract
Among mammals, spiny mice (Acomys spp.) exhibit the unique capacity to regenerate parts of their nervous system. Studying this phenomenon has the potential to reveal new targets that can slow or halt human neurodegenerative disorders. Unfortunately, research tools (e.g., transgenic lines, gene delivery vehicles) are lacking compared to those available for other rodent models. Here, we tested systemic adeno-associated viral vectors (AAVs) in Acomys dimidiatus and identified three promising candidates: X1.1, CAP-Mac, and MaCPNS1. Characterizing their tropism following intravenous delivery, we found that in the brain, MaCPNS1 and X1.1 primarily transduced astrocytes. In the peripheral nervous system, MaCPNS1 efficiently transduced dorsal root ganglia, axon bundles of the ear pinnae, and enteric neurons throughout the gastrointestinal tract. As a proof-of-concept, we used MaCPNS1 to chemogenetically modulate the activity of enteric neurons, successfully decreasing gastric motility in vivo and increasing colonic motility ex vivo. We expect these findings to enable functional studies of the uniquely regenerative nervous system of Acomys, which may in turn help advance neuroregenerative therapeutics for humans. Summary StatementIdentification of an AAV tool to efficiently deliver transgenes to the central and peripheral nervous systems of spiny mice enables functional studies of the nervous system in a mammalian model of regeneration.
Dumais, B.; Bossaert, M.; Seigneur, P.; Rozie, A.; Gasmi, S.; Caroff, M.; Maraval, V.; Bernardes-Genisson, V.; Gomez, D.; Frit, P.; Ballereau, S.; Genisson, Y.; Britton, S.
Show abstract
Several approaches are available to increase the efficiency of CRISPR/Cas9-based genome editing, including the co-inactivation of a gene that mediates the cytotoxic activity of a compound which can be used to enrich the population in edited cells. Here we show in multiple cell lines how inactivating HSD17B11, a non-essential Short-chain Dehydrogenase/Reductase, confers a strong resistance (29- to 130-fold resistance) in both human and mouse cells to a Phenyl diAlkynylCarbinol compound (PAC) without impacting cell viability and proliferation. We show how co-inactivating HSD71B11 along with selection with PAC is usable to quickly identify efficient guide(s) against a gene of interest and to readily isolate fully inactivated clones. Altogether, this work provides an experimental framework for the facile generation of knockouts using PAC for selecting successfully inactivated cells.
Belgrad, J.; Summers, A.; Hildebrand, S.; Sapp, E.; Luu, E.; Yamada, N.; O'Reilly, D.; Vogt, T. F.; Howland, D.; Yang, X. W.; DiFiglia, M.; Aronin, N.; Khvorova, A.
Show abstract
Huntingtons disease (HD) is a neurodegenerative disorder caused by CAG repeat expansion in the huntingtin (HTT) gene, with longer repeats linked to earlier onset. Somatic CAG expansion, particularly in the striatum, contributes to disease progression and is influenced by HTT biology and genetic modifiers. Modulating somatic expansion is emerging as a promising approach to slow or prevent HD, and mouse models have been crucial for preclinical testing of different therapeutic strategies. The BAC-CAG model, developed on the FVB strain, has been used to study somatic expansion of human expanded HTT. However, comparisons with other key HD mouse models have been limited by differences in genetic background, as many other models are on the C57BL/6 strain. The BAC-CAG model has now been developed on a C57BL/6 background. To determine whether the C57BL/6 BAC-CAG model can be used to study and modulate somatic expansion, we compared CAG expansion in mice on C57BL/6 or FVB backgrounds, with and without intraventricular divalent small interfering RNAs (siRNA) targeting HD modifiers MutS homolog 3 (MSH3) and HTT. Both strains exhibited robust, comparable somatic expansion over two months, which was blocked by MSH3-, but not HTT-, targeted siRNA. RNA sequencing identified gene expression differences primarily in pseudogenes, with no differences in endogenous Htt, human HTT, or mismatch repair genes. These results demonstrate that BAC-CAG mice on a C57BL/6 background exhibit somatic CAG expansion comparable to the validated FVB strain, providing a model to study and preclinically test therapies targeting somatic expansion in HD.
Armstrong, M.; Czechanski, A.; Swanzey, E.; Chen, Q.; Martin, W.; O'Connor, C.; Brunton, C.; Aydin, S.; Dewey, H. B.; Munger, S. C.; Reinholdt, L. G.
Show abstract
Genetically diverse panels of human pluripotent stem cells enable genetic dissection of cellular phenotypes, but comparable induced pluripotent stem cell (iPSC) resources in model organisms remain limited. We generated a panel of iPSCs from the Diversity Outbred (DO) mouse population and established 288 genetically unique lines that retain the allele frequency distribution, heterozygosity, and low population structure of the source population. The lines exhibit consistent growth, pluripotent gene expression profiles, and capacity to form embryoid bodies. Transcriptomic profiling of the lines revealed significant variation in gene expression driven in part by genetic background. We used expression quantitative trait locus (eQTL) mapping to identify over 10,000 regulatory loci that influence gene expression variation, including multiple distal eQTL hotspots that are key gene regulatory hubs and are shared with DO embryonic stem cells (ESCs). The largest hotspot, mediated by Lifr, showed a shift in founder allele effects relative to ESCs, consistent with differences in cellular state and culture conditions. These results establish the DO iPSC panel as a genetically diverse, publicly accessible platform derived from a laboratory mouse genetic reference population, enabling integration of in vitro cellular phenotypes with in vivo traits within a closed, outbred population.
Liu, H.; Yao, Y.; Wang, C.; Sun, X.; Zhang, Y.; Liu, K.; Yang, R.; Zhang, L.; Chang, L.; Xu, C.; Huang, J.; Gong, N.
Show abstract
The transcription factor FOXP2 is the most well-known language-related gene in humans, yet its role in primate vocalization remains poorly understood. Here we report that knockdown of FOXP2 in the striatum markedly disrupts vocalization stability in the marmoset monkey, a valuable non-human primate model for studying vocal behavior. FOXP2 exhibited high expression in the marmoset striatum, especially during early development. Using the CRISPR-Cas12 system, we achieved specific in vivo editing of the FOXP2 gene and effective knockdown of FOXP2 protein expression in the marmoset striatum. Two neonatal marmosets received bilateral striatal injections of the gene-editing and control virus, respectively, and were raised together in the same family. In three such marmoset pairs, analysis of vocalizations recorded during 6-15 weeks post-injection revealed that striatal FOXP2 knockdown significantly altered vocal features and increased intra-individual variability in phee syllables--the most common marmoset vocalization, often produced repetitively as multi-syllable phee calls. Notably, in FOXP2-edited marmosets, acoustic alterations were minimal in the first syllable of phee calls but became progressively more pronounced in subsequent syllables, which exhibited a marked upward shift in the frequency spectrum over time with progressively steeper slopes. These temporal dynamics in vocal features reflect a reduction in the stability of continuous vocal production. In line with the known striatal functions in motor control, our findings provide the first evidence of FOXP2 in controlling vocalization in non-human primates, thereby opening new avenues for investigating the neural mechanisms underlying FOXP2 function.
Ono, S.; Ono, M.; Brettschneider, R.; Sauer, D.; Mueller, K.; Balboni, M.; van der Heide, M.; Schnittger, A.
Show abstract
The ability to insert, delete, or modify genetic information is crucial for mechanistic studies and biotechnological applications. However, efficient genetic transformation remains a major bottleneck for research in maize and many other crops. Here, we report an optimized Agrobacterium-mediated transformation platform based on systematic reconstruction of tissue culture handling in the maize inbred line A188. Refinement of callus induction, selection, and regeneration substantially improved recovery of transgenic plantlets. To distinguish independent T-DNA insertion events, we developed TAFLP (T-DNA Amplified Fragment Length Polymorphism), a simple and inexpensive assay that amplifies T-DNA flanking sequences and can be performed using standard laboratory equipment. Our enhanced transformation pipeline was also applicable to the inbred line B104 as well as to hygromycin and G418 selection systems, demonstrating broad utility of our method. We validated the platform for CRISPR/Cas9 mutagenesis and reporter line generation. Using this approach, we isolated new loss-of-function alleles of MAC1 and ACOZ1 and generated reporter lines for analysis of meiotic protein dynamics. Together, these results provide a broadly applicable framework for improving maize transformation efficiency and recovering independent transgenic and genome-edited events.
Ezer, S.; Yanovsky-Dagan, S.; Granit, A.; McDougal, M.; Hwang, T.; Antman, I.; Karni, R.; Yoon, W. H.; Saada, A.; Harel, T.
Show abstract
Pathogenic variants in ATAD3A cause a spectrum of multisystem disorders, with a recurrent dominant-negative variant (c.1582C>T; p.Arg528Trp) associated with neurodevelopmental disease. Given the tolerance of ATAD3A to heterozygous loss of function variants, allele-specific transcript reduction represents a promising therapeutic strategy. We designed and optimized allele-specific antisense oligonucleotides (ASOs) targeting the c.1582C>T transcript and evaluated their efficacy and specificity in affected fibroblasts using allele-specific primers and amplicon-based next generation sequencing. Therapeutic potential was further assessed in vivo in zebrafish embryos expressing human wild-type or mutant ATAD3A transcripts. An optimized gapmer ASO selectively reduced mutant ATAD3A transcripts while relatively sparing the wild-type allele. In addition to RNase H-mediated degradation, the ASO induced exon skipping, leading to degradation of the aberrant transcript without production of a truncated protein. In zebrafish, expression of mutant human ATAD3A in embryos caused developmental abnormalities including reduced eye size, which were robustly rescued by co-injection of the optimized ASO. Our findings provide proof of concept for allele-targeted ASO therapy for dominant-negative ATAD3A variants. This work highlights the therapeutic potential of ASOs for rare dominant disorders involving genes tolerant to heterozygous loss-of-function, and establishes zebrafish as a versatile platform for in vivo ASO optimization.